Olepa ricini
EOL Text
Statistics of barcoding coverage: Olepa ricini:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Barcode data: Olepa ricini:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 5 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CTGCCCCCTTCTATTGCTCTTTTAATTTCTAGAAGAATTGTGGAAAGCGGGTCAGGAACTGGATGAACAGTATACCCCCCATTATCATCTAATATTGCTCATGGAGGAAGATCTATTGATTTAACTATTTTTTCATTACACTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATCACTACAATTATTAACATACGATTAAATAATATATCATTTGATCAAATACCCTTATTTGTTTGATCTGTGGGAATTACAGCATTTTTATTATTATTATCATTACCAGTATTAGCAGGAGCCATTACTATATTATTAACAGATCGAAATTTAAACACTTCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGCCATCCTGAAGTATATATTTTAATTTTACCTGGATTTGGTATAATCTCACATATTATTTCACAAGAAAGAGGAAAAAAAGAAACTTTTGGATGTTTAGGAATAATCTATGCTATAATAGCA
-- end --
-- end --
Olepa ricini:
Olepa ricini is a moth of the Arctiidae family. It is found in India and Sri Lanka.[2]
References[edit]
| This Spilosomina-related article is a stub. You can help Wikipedia by expanding it. |
| License | http://creativecommons.org/licenses/by-sa/3.0/ |
| Rights holder/Author | Wikipedia |
| Source | http://en.wikipedia.org/w/index.php?title=Olepa_ricini&oldid=647985959 |